Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14167A6
Clone ID IST14167A6
Vector VICTR74
Project tigm

Sequence tag IST14167A6HMR1
Sequence
CACCTGTGGTGCCNGCATCCCTCTTGGGTGTTCACTGATAGCTT
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26656891..26656934 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST14167A6BBF1
Sequence
GGTGTTTATGACCACACCACATCATGTGGCGCTGAGGATGGAACACAAGGCTTCGAAGAATCCAGGCAAGCACTCTCTCA
ACTGAGCCCCGGCAGTGGCTGCTGGGATTTTTTGGTCTGAGAAAGGGTCTCATTATATATATCCTAGCTGGCTTGAAACT
CATGCATGGTTTCATGGCTTGAAACCAGGCTGGCTTCAAACTAACAGAGATTCACCTGCCTCTGCCTCCCAAATGCTGGT
ATTAAAGGTGTGTGCCACCAAACTTGGTAACTANCCCCTTTTTTGTTGGTTCGGTTNAGGGACAGCNCATCCCCCACCGC
CNTGTANCACNGNGTGATCCAGANTCAAGATCCTNNTGCCTNANCCTTTTGAGTTNAAATCTCAGGTGTGTNTNNCCNNN
TGTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es