Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11637H9
Clone ID IST11637H9
Vector VICTR76
Project tigm

Sequence tag IST11637H9HMR1
Sequence
ATGCGGATAGACCTTCATATGTTTATGCTTGACTTAAACATCTTTTACGTAACAAAAACATCGTTGGGAACTGTTAGTTG
AGCCGTTCACCAAGAACAAACAGAATATTATCGCTGATGGCTGGAAATCTTTTCAAATATGTTGTACAGGTAGCCCGCAT
GGTGGATCTGCCGGCCAACAAGTGTTGACGGGCAGTTTGTCGAATGCTTGGGACTGCAGCAAGTTTGAAATACTAAGTCC
CGAGAAAGGCANCTTGGCAGGCCAACTATCANGATGCTGGTGGTGTGCAGAGTGGAAGCCTGGCCGGCAGANGCTGGGCC
GCTCGGCTTTGGGCGCANATGTGTCANATACATTTTTAGTGTANATTTCCGANAGTGGAAAGAGGGAANCGGGCCGCNNG
NANTTATGGCGGGGTAAAANANNTGCNTGATGGTN
Sequence Type genomic DNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40215904..40216337 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es