Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G064A07
Clone ID G064A07
Vector U3CEO
Project ggtc

Sequence tag G064A07
Sequence
AGGGACCTCCTCTGCTCCGCCGCCGGGCGAAGTGCTGGGAGACCCAGCCGCCTGTCGCGCTCCTGCAGGGGGACCCTCAG
CTAGGCAGCCAGCTGGCGCCCGCGTAGATGGCGAGGAGCCCCCAAGGCCTCCTGATGCTGCTGCTGCTACACTACTTGAT
CGTCGCCCTGGACT
Sequence Type mRNA
Unitrap ID UNI243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84774625..84774798 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es