Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14404D8
Clone ID IST14404D8
Vector VICTR74
Project tigm

Sequence tag IST14404D8BBF1
Sequence
ATCCGCAACTCGTTCTCTTAAAGAGGAAACCCGGACGCCGTCCTAAACAGCTGTAGCTGTTTCGCATACGGTCTTGGCGC
GTCCCTCGGGGTCAAGGCCATGACGGGGCGGCCCCTACCGCCCCAGCCAGGCCCGCGCGTCCTCTTCGGAATTCATAGCC
TTATTTAGACCGCGCCACCGCCGTGCCCGTGAGAACAGCTGCTCGGCTGGCTACAGGAAGTANAGGCCCGCGCGCCTGAC
CCGGAAGCGCATGCTGGTCCCGCCCTCTCGGCNCCCGGCTTCCTTCTGCAACAGGCGTGGGTCACGGGCTCGCNNNTTCT
CTTTCTGCCGCCATCTTGGTTCCGTGATCTCCGCACAGTAAGTGCCNNTNNCGTNNCNGCN
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472383..127472748 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


Sequence tag IST14404D8HMF1
Sequence
ATCCGCAACTCGTTCTCTTAAAGAGGAAACCCGGACGCCGTCCTAAACAGCTGTAGCTGTTTCGCATACGGTCTTGGCGC
GTCCCTCGGGGTCAAGGCCATGACGGGGCGGCCCCTACCGCCCCAGCCAGGCCCGCGCGTCCTCTTCGGAATTCATAGCC
TTATTTAGACCGCGCCACCGCCGTGCCCGTGAGAACAGCTGCTCGGCTGGCTACAGGAAGTAGAGGCCCGCGCGCCTGAC
CCGGAAGCGCATGCTGGTCCCGCCCTCTCGGCGCCCGGCTTCCTTCTGCAACAGGCGTGGGTCACGGGCTCGCTCGTTCT
CTTTCTGCCGCCATCTTGGTTCCGTGANCNCCGCACAGTNNGTGCCNCTGGCGTCTCTGCTTTN
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472383..127472765 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es