Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14499A1
Clone ID IST14499A1
Vector VICTR74
Project tigm

Sequence tag IST14499A1HMR1
Sequence
NNCAGAACTTGCCNGAACGTACAGGGGTTCCTGGAGTGGTGGTGACACAGTGGGTTCTCGTTTCTAAACGACGCATAATG
ACTTTTTAAACTCTTTGCTCTCTCCTTCATCCCTAACCTGAAAAGAAGTGGCTGTTAAAATAAGGAAGTGGCCTTTCTTC
TAAGCCTTGAGCTGTACAGTTATCTCTCTGGCTTTGAAAATAGGCTTCATGATTTCCAGCCATTTTGTCCAAATACTTGA
TTATCATTTATCTTCCAGAGTTTGTAGGAATGCTAACGTTAANTTCATTTTCTCCANTATTTTCTTTATTTAAAAATGTA
TTTAATANACNCNGTTC
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755872..107756205 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


Sequence tag IST14499A1BBF1
Sequence
GTACTCTGTGGCAGGTAGCACATGAGTGTCTAAGCGCGGCTTGGAGACTGAGAGCTCCCCTTTTAGACTCTTCCCACAGC
CAGGGATAAGGTCAGGGCTAATTCAGCCCCTGCTCCACAGCAAACGGGGCAGCGGACAGAGCCCTACCTACTTATCATCT
GATTTGCTTCAAGCGTTCAAACTCACTAAGATCCAGCCAGTACTCAAAGACGTCTCANCAAAGCCACAGGGACAGACTTT
GGCCTGCAGGCTCTCAAAGCTTTGCAACACAAAGGCTATTTTACAAACTGCACTTGTTCTAATGTCACAGAAGACTGCAG
GCTTCAGANCTGGAAGGANNNAAGANGGTCATGGAGAGAATGGTTGTGGANAGGAATCGGGGTGAGTTNNCCTACTTCCT
GTCNAGTCNCATGCTCTGCTAGCTAGANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755440..107755872 405
NO GENE  


Sequence tag IST14499A1HMF1
Sequence
GTACTCTGTGGCAGGTAGCACATGAGTGTCTAAGCGCGGCTTGGAGACTGAGAGCTCCCCTTTTAGACTCTTCCCACAGC
CAGGGATAAGGTCAGGGCTAATTCAGCCCCTGCTCCACAGCAAACGGGGCAGCGGACAGAGCCCTACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755725..107755872 148
NO GENE  

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es