Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14873E11
Clone ID IST14873E11
Vector VICTR76
Project tigm

Sequence tag IST14873E11BBF1
Sequence
AACCAAAATAAAATAAAATAAAATAAAATAAAATA
Sequence Type genomic DNA
Unitrap ID UNI31595 UNI31596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 7501125..7501159 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 44385937..44385971 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038725 (Pkhd1l1) NP_619615 polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86324308..86324342 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100865941..100865975 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119972482..119972516 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72367358..72367392 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48718072..48718106 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 90180838..90180872 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33882718..33882752 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807492..108807526 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034551 (Hdx) NM_001080549 highly divergent homeobox Gene [Source:MGI (curated);Acc:Hdx-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26373051..26373085 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 65853890..65853924 35
NO GENE  


Sequence tag IST14873E11HMF1
Sequence
AACCAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATATAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 90180838..90180889 48
NO GENE  

 
Come back to gene ENSMUSG00000034551


For any suggestions or comments, please send an email to unitrap@crg.es