Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10188E10
Clone ID IST10188E10
Vector VICTR76
Project tigm

Sequence tag IST10188E10HMF1
Sequence
CTAGTATTGTGATCTCATAAGCTTTGACTTCTGTTTTGCCATCTCTAATATGGTAGTATTTATACTACTTATATTTGTAC
TTATATTAGTTTGTTTCTCATTGCACAGAGAAGTGTCTGGGGGGAGGCCTTAAGGAAGGTTTCATTATGGCCTACTGTTT
GAAGAGATATAATCTGTCATGGTATGGAAGGCAGGGTGATGGGACCATGTANTGAATTGCTTCTACAGTCAGGAATCANA
GGTAAATTCTGGTGTTTGGCTGACCTCCTATTTTGGGTCTTTTTATTNNNTCTGGAACCCTATTCCATGGGATGGTGACT
TA
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16087743..16088063 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]


Sequence tag IST10188E10BBF1
Sequence
CTANTTTTGTGATCTCATAAGCTTTGACTTCTGTTTTGCCNTCTCTAATATGGTAGTATTTATACTACTTATATTTGNAC
TTATATTAGTTTGTTTCTCATTGCACAGAGAAGTGTCTGGGGGGAGGCCTTAAGGAAGGTTNCATTATGGCCTACTGTTT
GAANANATATAATCTGTCATGGTATGGAAGGCANGGTGATGGNACCATGTANTGAATTGCTTCTACAGTCNGGAATCANA
GGTAANTTNTNNNGTTTGGCTGACCTCCTATTTNGGGTCTTTTTATTCAGTCTGGAACCCTATTCCATGGNATGGTGACT
TGCATATTGAGAGTANTATTCCNTTTTCTGCTAANCCTCGCTGNAAACATCCTTNGGTNACNCCCNNNGATGANGNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es