Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12781A1
Clone ID IST12781A1
Vector VICTR76
Project tigm

Sequence tag IST12781A1HMF1
Sequence
ATGGCAGGCCTAAGTGGTGGAGGTGGGATTCAAAGCCAGCTAGGACATGCTTAGGTGCTGAACAGAGTCTTCATGAGAGA
CTCACTTGGGGCAGGGATAAGGTTACCCACAGGCTAGAGAAGGTAGAAGGGATGATTCTAGAAGGAAGAGATGACACACT
TCCATCCTGAANATGCCAAAGGAACATGAGAAGTGGTGCTTGTAGGTTTTATGGGGGACCCCAGGGGAACTAGGGACATG
GCAGCAGAAGATCTGAGGAGAGATGCTACACTAACAAGTATAGCCCTTATGGGAGCTGCCAAGTAA
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69505002..69505306 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST12781A1BBF1
Sequence
ATGGCAGGCCTAAGTGGTGGAGGTGGGATTCAAAGCCAGCTAGGACATGCTTAGGTGCTGAACAGAGTCTTCATGAGAGA
CTCACTTGGGGCAGGGATAAGGTTACCCACAGGCTAGAGAAGGTAGAAGGGATGATTCTANAAGGAANANATGACACACT
TCCATCCTGAANATGCCAAAGGAACATGANAAGTGGTGCNTGNNNGTTNNANGN
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69505105..69505306 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es