Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10951G11
Clone ID IST10951G11
Vector VICTR76
Project tigm

Sequence tag IST10951G11HMR1
Sequence
ANTCTGTCGTAGTTAGAAATGCACACCTTTGGTTTAAGAAGCTCTCCTGTCTCCAGGACGTGTTTCTCTGCAGCTGTCAA
AATTTAGGTGGCTGTGACTGTGTGGGTTTATTTCTGGGTTCTCCTTTCATTTCTGTTTAACTTACTGTGACTGTTGTGTG
CCAATGCCNGGCTGGGTTTGTTTGNNNGTNNACNANNCN
Sequence Type genomic DNA
Unitrap ID UNI1597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116360123..116360304 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027958 (Hiat1) NM_008246 hippocampus abundant gene transcript 1 Gene [Source:MGI (curated);Acc:Hiat1-001]

 
Come back to gene ENSMUSG00000027958


For any suggestions or comments, please send an email to unitrap@crg.es