Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P027G02
Clone ID P027G02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P027G02
Sequence
CCCTCCCAGATCCAGGCACATCCTACCTGCCCCAGGACCCGTCGAGAACAGTTCCAGGCAGATACAAAAG
Sequence Type mRNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107819883..107828788 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es