Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10249H12
Clone ID IST10249H12
Vector VICTR76
Project tigm

Sequence tag IST10249H12HMF1
Sequence
NTGTTANCTCAAGTGAGAGAAGAAAATACAACGGCTCTCTTCTATCTGCTGTTTCAGTTTCTGCTGTTTCAGGGTGGTCC
AA
Sequence Type genomic DNA
Unitrap ID UNI31605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144008166..144008245 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]


Sequence tag IST10249H12BBF1
Sequence
GTGTTAGCTCAAGTGAGAGAAGAAAATACNACGGCTCTCTTCTATCTGCTGTTTNAGNTNNNGNTGNNNNAGGGTGGTCC
ACTGTGGCCCCAAGCACCACGTAGAATATTCCAGAAACAAACAATTCAGAAGTTTAAAGTTGCATGTTGCTCTGATGAAA
TCTTTNNNCACCTGCTCCACCCCACCTGGAAGGTAAATACCTCTTCGCTCCATGGATTCCTGCTGTGTACACCACCCACA
CGTTAGCCACTCTGGNTGGCTTGGCTATNANATTCTNTGCAGCAGAACTGCNNTACTGTGTACATTTACTTAANNNNGGC
TCTCAAAGGCAAAAGTTGTGATGTTCTACGTTGNNATAATTTGNTGNAATCTCTGGCTGTGCAGAGTTNATGAATAAACT
TCATNAGNGGCNTGTGTGTGTGTGTGTGTGTGTGTGNGNGTATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074758


For any suggestions or comments, please send an email to unitrap@crg.es