Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626G9
Clone ID IST14626G9
Vector VICTR74
Project tigm

Sequence tag IST14626G9HMR1
Sequence
ANCCTGGAATGACTTTATTTCCNATCGGGTAGCAAAGGAAGTGAGAGGCTGACTTTGAACAAAGACTTGCAGGCGGTGGG
GGCCTTGGCTGCTCAAGAGCTCCACTTAGCCTGAAGAGAGTCCCAGTAAAGCTGCCTACCAAGGGCAAGCCCCAAGGCTT
CCTGGGACAGCTGTGGGGTTGCAGGTGGCTTTAACAGAGCAATGGTGTCACACTGANCNGGTGGGGAGCCNGGTTTTGAN
AANAGAGGGGCANGGGGCCNTGTCNGATCTNGTGTN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66541880..66542150 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST14626G9BBF1
Sequence
GCTAGACNAAAGAAAAACACAATCCAGACAGTGTTTTATCTTTTGACAGAAACACATCCGGGAAGAAGTACCCACAGTAA
CTATTCAATAGCGAACATTCACTTCTTTCCAATAGCTGATTCGTGTCCTTCTGTTTGCAAAAATAAGACAGCTAGAGAAA
TTAATCTAAGGCACGCTAAATACAACACAATGAAAGANGAGAGCCGGGCTGGTGAGATGGCTCANTGGGTAAGANCACCC
GACTGCTCTTCCNAAGGTCGGAAGTTCAAATCCCAGCAACCNCATGGTGGCTCACAACCNTCCNTGACNAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66542153..66542468 298
 
EST/CDNA Est Name
  AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ175652.1 - CJ171218.1 - CJ171336.1 - CJ172146.1 - CJ170013.1 - BY336090


Sequence tag IST14626G9HMF1
Sequence
GCTAGACCAAAGAAAAACACAATCCAGACAGTGTTTTATCTTTTGACAGAAACACATCCGGGAAGAAGTACCCACAGTAA
CTATTCAATAGCGAACATTCACTTCTTTCCAATAGCTGATTCGTGTCCTTCTGTTTGCAAAAATAAGACAGCTAGAGAAA
TTAATCTAAGGCACGCTAAATACAACACAATGAAAGATGAGAGCCGGGCTGGTGAGATGGCTCAGTGGGTAANAGCACCC
GACTGCTCTTCCGAAGGTCGGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCNTCCGTGACGAGATCTGACGC
CCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACNTATAATANNTAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66542153..66542527 365
 
EST/CDNA Est Name
  AA797245.1 - CB236345.1 - BY708044.1 - BE374926.1 - BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ175652

 
Come back to gene AA797245.1 - CB236345.1 - BY708044.1 - BE374926.1 - BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ175652


For any suggestions or comments, please send an email to unitrap@crg.es