Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13075D7
Clone ID IST13075D7
Vector VICTR76
Project tigm

Sequence tag IST13075D7HMF1
Sequence
CTATTTATATGAAGTATCAACAATCATCAAAATCTGTACAGGCCAAAAACAAAAAACAAAAAAACACAAAACAAAAAACA
AACCAAAACCAAACCAAACGAAAAGCCCTAAAAACAACTAGCANAACTCAGGGATAAGGAATGGGTGCTCGGTTTCTTTT
TGANATGCTAAAATGCTCTAAAACCTGACCTAGGTGATGATGGA
Sequence Type genomic DNA
Unitrap ID UNI31609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36136145..36136347 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030494 (Rhpn2) NM_027897 rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI (curated);Acc:Rhpn2-001]

 
Come back to gene ENSMUSG00000030494


For any suggestions or comments, please send an email to unitrap@crg.es