Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14661G12
Clone ID IST14661G12
Vector VICTR74
Project tigm

Sequence tag IST14661G12HMR1
Sequence
CCTTCCACANTANCACACCTGCTTTCTTGTGGGATATACTCTGTAGCATACCTCTGGCTTATACAGAGGGGATGCCCAGC
CTCAGATGGGGAAGAGTAGCCACATTCACAAAGGAGGAAAGGGTTCTCCACGGCTGCCATGGGTCTAGTCAAGAGAGAGG
TCTACCAACTATGTCACTGGTAGGTGACTGAAAAGGGTANTCCAGCTGGCTGTGATGGTACACACGTGTAACCCCAGCGT
TCANGAAGCTTANGCAAGAGGATTGCAGAGAGTTTGAGTTCAGTCTGGGCGACATCATAAGCTGTTATTTCAAAAGCACA
CNTTGAGTGTGGTC
Sequence Type genomic DNA
Unitrap ID UNI31610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13628076..13628408 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030380 (Mzf1) NM_145819 myeloid zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:107457]


Sequence tag IST14661G12HMF1
Sequence
NGGGGTGTGGAGCCTCCCCTGGAAGCCGTGTTTGCATAGCTTATACCAGCATGGAAACAGCGGTAAAGTGGGCAGAAGAA
ATGTGCAGGTTGGGGAGACATCATGTGTTTATTGAGCACCTCCTGAAGCCCAGGCTTTACTGGGGCCTGTTGGGAGATGC
CTGCCTCACAACAACCTTGTGAAGTGTTTTCACAGCTCAGTGCTGTACAACTACTCAGTGCTGTGGACACGCTGGTGCTG
GATGAGCTTGGTGCTCTGGTTGAAGCGTCGGCCACAGTCCTGGCAGGCGAAGGGCTTTTCGTGCCGGTGAGTGCGCAGGT
GCTGCGTGAGCGTGGGCCGCTGGCGAAAGGCCTTGCCACATTCNGGACACGCGTANGGTCNCTCNCCCGTATGGATGCNC
CNGTGCTGGGTGANGTTGGCGTGCTNCCGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13628408..13628837 414
 
EST/CDNA Est Name
  BB855381.1 - CA542859.1 - BX632206.1


Sequence tag IST14661G12BBF1
Sequence
AGGGGGTGTGGAGCCTCCCCTGGAAGCCGTGTTTGCATAGCTTATACCANCATGGAAACAGCGGTAAAGTGGGCANAANA
AATGTGCAGGTTGGGGAGACATCATGTGTTTATTGAGCACCTCCTGAANCCCAGGCTTTACTGGGGCCTGTTGGGAGATG
CCTGCCTCACAACAACCTTGTGAAGTGTTTTCACAGCTCANTGCTGTACAACTACTCANTGCTGTGGACACNCTGGTGCT
GGATNANCTTGGTGCTCTGGTTGAANCGTCGGCCACAGTCCTGGCAGGCGAANGGCTTTTNNTGCCGNTGANTGCNCAGG
TGCTGCNTGANCNTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BB855381.1 - CA542859.1 - BX632206.1


For any suggestions or comments, please send an email to unitrap@crg.es