Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12061C11
Clone ID IST12061C11
Vector VICTR76
Project tigm

Sequence tag IST12061C11BBF1
Sequence
AGGTAAGTGCTCGCCCACTGAAGCATATCAGGTGGTGGTTTGCTTCTGTTAAGACAAAACTCAGGCCTCATACATGCTAA
GCTAATGCTCTCCCATTGTGCTACAACCCCAGCCTCAGTATGTTTTCTTTACATCAGCCACATGCAGGATGTATGGAAGT
TGTTTTGCATGGTTGAGTGAAAATTGGGATATTTTAGAAGTGAGTTTCATTTTAATAAATATACAGATTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92042210..92042444 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST12061C11HMF1
Sequence
AGGTAAGTGCTCGCCCACTGAAGCATATCAGGTGGTGGTTTGCTTCTGTTAAGACAAAACTCAGGCCTCATACATGCTAA
GCTAATGCTCTCCCATTGTGCTACAACCCCAGCCTCAGTATGTTTTCTTTACATCAGCCACATGCAGGATGTATGGAAGT
TGTTTTGCATGGTTGAGTGAAAATTGGGATATTTTANAAGTGAGTTTCATTTTAATAAATATACAGATTAGATCTAGATT
CTGTATTGGTTGTGGTTGATGTTTTCANAAGTTTTTCCCTGCTTAATTTGTAGAGATTGGTGCCAATCTATCTTGGGTGA
NCACCTGCTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92042210..92042542 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es