Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P032F02
Clone ID P032F02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P032F02
Sequence
GCGGATCGCTTAAAGGGGTAGGGGGAGATTTGCGCGCCTTTCGAGCAAGTTTCCCGCCTTCGACATTTTCCAGAACTGGA
AGGTCCTCCTGTCTGACAGTTGTTTCTTTTGGTTTTTGGCAAGGTCCAAGAAG
Sequence Type mRNA
Unitrap ID UNI10410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121332467..121332599 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es