Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14251E5
Clone ID IST14251E5
Vector VICTR74
Project tigm

Sequence tag IST14251E5HMR1
Sequence
CAACAACAACGTGAGCGTGGCCTACGAGTGTCTGAGTGCCAGCGGCCGCAAGAAGAAACCGGGGCTGGATGGGCGCACGT
ACAGCGAGCTGCTGAAGCGTGTTTGCANGGACGGCGN
Sequence Type genomic DNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79138154..79138269 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]


Sequence tag IST14251E5HMF1
Sequence
TTTGAAGGCGGTCCTGCAGGGACAGTGGGGTGTCAGCAGCCCCCAGTCTGGCTGGCNNNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79138102..79138156 55
NO GENE  


Sequence tag IST14251E5BBF1
Sequence
NTTGAAGGCGGTCCTGCAGGGACAGTGGGGTGTCNNCANCCCCCANTCTGGCTGGCCNCCTGGGCCTTTCCNNANTCACC
TCAGCTCTTCNTTTGTCTGCCTCTCCCTTTANAGCACCNNGCACCCCAAGTGTTTGCTTTCTTAAAATTNATTTAAAGCC
TGGCNTGGTGACNCACACCTTTAATCCCAGCACTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es