Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10056D11
Clone ID IST10056D11
Vector VICTR75
Project tigm

Sequence tag IST10056D11HMF1
Sequence
AGCGTATAGGTTACATCATTAAAAGAAGCCAAGGCAGGAAGTGACGCAGAGAACCATGGAGGAATGCTGCTTACTGGCTA
GCTTGCACCACCCACAGTGGGCTGGGCCCTCCTACATCAATCAGCAACCAAGAAACACCCCTAAGACACGCTCTAGTCCC
GGGGGAATCTTTGGAGGCAGTTCACCAGTTTTCCCTTCCCAAATGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78787073..78787281 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es