Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13068F1
Clone ID IST13068F1
Vector VICTR76
Project tigm

Sequence tag IST13068F1BBF1
Sequence
TTATGTAAGTACACTGTAGCTGTCTTCAGACAGCACCAGAAG
Sequence Type genomic DNA
Unitrap ID UNI1052 UNI6927 UNI30296 UNI31624

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 85785865..85785905 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 47511559..47511599 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 30551049..30551089 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061911 (Myt1l) NP_001087245 myelin transcription factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1100511]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106727108..106727148 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108184717..108184757 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52754884..52754924 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23656391..23656431 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 119997827..119997867 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72346627..72346667 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135356555..135356595 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9153349..9153389 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147410057..147410097 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029016 (Clcn6) NM_011929 chloride channel 6 Gene [Source:MGI (curated);Acc:Clcn6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71924606..71924646 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049044 (Rapgef4) NM_019688 Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI (curated);Acc:Rapgef4-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 195080428..195080468 41
NO GENE  

 
Come back to gene ENSMUSG00000049044


For any suggestions or comments, please send an email to unitrap@crg.es