Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15063B2
Clone ID IST15063B2
Vector VICTR80
Project tigm

Sequence tag IST15063B2HMF1
Sequence
ANTTATANGCAAGCACCCACACACATTAAGTTAGTTTAAAACCTTTTAAATATGACTTGGATTTCATAGTAGGATGAATT
TGGGAGTTTCGGCTTAGGGATGTTCAACTAGCACCTGTGTATGACAGAATAGAAGGCAGGGAACAGGAAGTTAGCAGGAA
GAGTTTCCTTCATGTACCCTCCATTTTCAGGAAGAGACTTCCTGAGAGCTCCAAGGCGATCCTTTCCGTGCTGTTAGTGC
AGGCATTGCCTTCTCTGTCACCAGCAAAGGAGGCAGCTCCGTCCTGACCCACTGTGATGCCAGAGTGGCAGCTGACAGGA
TGGGGATTGGGCTGCCCACTGTCTGTGTTTGTCACAAGCAGGGGCACCCTATTCCCTGCCTCTTCCTGACTCTGCTGGGC
TAGCTTTGGGCCNCTTTGAGAAGAACAAAGGAAGAAGGCGTTGGGAANAANGGTGCTGTTATCACTCCNGTCTGTCCTAT
TGTGCTCCTGCCNTCTTGGGGCCTCCTTTATTCCTCANCCCNGNNTCNNANNCCTCTCTCCCCTCCCCCTGN
Sequence Type genomic DNA
Unitrap ID UNI21324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72957275..72957823 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es