Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14789B12
Clone ID IST14789B12
Vector VICTR76
Project tigm

Sequence tag IST14789B12HMR1
Sequence
NNAGTGAGTTGCAGGACAGCCNGGGTGACACAGAGAAACCCTGTTTTGAAAAAAACTAAAACAAACAAACAAAAAACCAA
AAAAAACCAACAACACCNTGANCAAGCCAGTTGGGGAGGAAAGGGTTTATTTGGCTTACACTTCCATATCACTGGGTAGG
AGCTGATGCAGAGGCCACGTAGGGGTGCTGCTTACTGGCTTGCTTCTCTTTGCATTCTCAGCCTGCTTTCTTATANAACC
CAGNATCCGCTATCCCAGGGATGGCAGCACTCACAACTCCATCCATAACTAATTAAGAAAATGCCCCACAGGCTTGTCTG
GAACCCANTCTTATGGATGTTGCCTTTTCTTCNTTGAGGGTCCCTCCTCTCANATAACTTTCGCTTGGACCAAGATTATT
CAGCACATAGCCNATATCTTTCTCTCNCNCNCNCTCTCTCNCNCN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34931624..34932060 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14789B12BBF1
Sequence
TCTGTANACCNNACTGGCCTCGAACTCNNAAATCTGCCTGCCTCTGTCTCCCNNATGCTGGNATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14789B12HMF1
Sequence
TTCTGTAGACCAGACTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGTCTCCCAAATGCTGGGATTAAAGGCATGCGCCA
CCACTGCCCGGTGAAGGCCAGCTTTCTTAAAATGTCTTTTANTAAGGTCTCTATCTGTTGTCCNNCCTGACTTCNCTCTT
GCCTCTCCNNTNCTCNCANGGNTNNCNGGTGTNNNCCCCTGCCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es