Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P012G10
Clone ID P012G10
Vector FlipROSAbetageo
Project ggtc

Sequence tag P012G10
Sequence
CGTAGGCGCAGCCGGCCTAGCGAGGTCAACATGCCGGTCGCCAGAAGCTGGGTTTGTCGCAAAACCTATGTGACCCCACG
GAGACCCTTCGAGAAGTCGCGTCTCGACCAGGAGCTAAAGTTGATTG
Sequence Type mRNA
Unitrap ID UNI11175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3655924..3656050 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es