Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P074D05
Clone ID P074D05
Vector FlipROSAbetageo
Project ggtc

Sequence tag P074D05
Sequence
AGTCAACTCATGNNNGGCCCCATCAAAAAGAAGCTCAAAATTATCCCTGAGGATATCTCCTGGGGAGCCCAGGCATCTTA
CGTCTTCCTAAGCATGGAAGGGGACTTCATGAAGCCTGCCATCGACGTTGTGGATAAGTTGCTGGCAGCTGGGGTCAATG
TGACCGTGTACAACGGACAGCTGGATCTCATTGTGGACACCATAGGTCAGGAGTNNNNGGTACCTTAGTATAGTATACCA
TATCTGTACAAATCCAATTAGTTCTAGAGGGAGGAACTAGACGATGATCCCAAGTGTTCAGAAGCAGGTGCGTTAGTCAA
GTCGTATGAGAACCTAGCCTATATACAGGATCGTTAAANNGCCGGTCACATG
Sequence Type mRNA
Unitrap ID UNI10676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88790479..88794828 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es