Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10036G11
Clone ID IST10036G11
Vector VICTR75
Project tigm

Sequence tag IST10036G11HMF1
Sequence
CAGCCAGGGTAGGTCAGGAAAGGGCATCTGGATTAGGAGAAAATCTAGTTTATATCCCCTTTCAGCCACAACACAGCAAA
CCTTAGATCAGTGGGCAGTTGCCATTCATCCCTTGTCCTGACCCCAGCGGTTCACACCCATTGCCTGGTGTAGGTGAGCC
GGTTGCAGTTGAGAAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26410406..26410585 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]


Sequence tag IST10036G11BBR1
Sequence
CTGTAAATCTAAACAGGCAAGATAGATAATAACTGCTGATTCTTGTCTGTCTCTTCCAGAAGGTATTTACGAGACTGTCG
GCTTGCAACACTCGGAGAAAAAGTTCCCATACTAACTTGCTCACTGCCTGGCAAGCCCTGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26410264..26410408 145
NO GENE  

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es