Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14180F5
Clone ID IST14180F5
Vector VICTR74
Project tigm

Sequence tag IST14180F5BBF1
Sequence
GGNGGGAGAAAGGGAAGGAGAGAGAAAAACAGACTGACAGANACACAAAAAAGATGGCGAGTTCTTTTTATCTACNAGCC
AGGCTCATACCTGGCTGTTGCTAGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102591756..102591861 100
NO GENE  


Sequence tag IST14180F5HMR1
Sequence
GTAAGGGCACCTCTGAGCCCCTTGCTTTGAGTCGGGCTGTTTATGGCAGGCCN
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116759760..116759811 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]


Sequence tag IST14180F5HMF2
Sequence
CTGGTAGTCCGGGTGATTTCTTGCCCACTCCATTCTCCACAGAGGCTGGCTCACACCACAGTCGCTTAGGGAGCCCAGGG
CCCCCAGATCCACTGGCTTAAGCTCCAGTACCTGCTGCGAACTTCCCACAGCTCCTTCCTCTGACCTTTCAAGACACTCC
TTCCAGCCNAGTGAGCAGAGCTAGCGCAGCTAGCCAGTCAGGCTGGTTGTCATGGAGACCTGTCCTANGCTGCACACACG
CTTGCAGGCTTGCTCTCACTCAGCTAGGCGCTCTCCCTCAACCCGGTGTCCCANGAGCNANNNAGCACGCGCACGTTTAT
GCNTGCGCNTGCTTCTACACATTCTCTGANTTCTAGCCGGCCTTGAAACNNCGCGGTCTTTTGATCGGCTCANTTTATGC
ATGCATTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116759812..116760218 381
 
EST/CDNA Est Name
  BC051034.1

 
Come back to gene BC051034.1


For any suggestions or comments, please send an email to unitrap@crg.es