Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13109F4
Clone ID IST13109F4
Vector VICTR76
Project tigm

Sequence tag IST13109F4BBF1
Sequence
NGTTGTGAGCCACCATGTGATCGTTGGGAATTGAACTCNNGTCCTCTGGAANAACATCTTAACCCCTCCTANCCACTGTG
CCATCTTTCTAGTCCCTAAAGCCATTTTTTAAATGTTTGCCACAAAGCCGTGAGTTGTCCATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84090301..84090447 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034453 (Polr3b) NM_027423 polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]


Sequence tag IST13109F4HMF1
Sequence
GGTTGTGAGCCNCCATGTGATCGTTGGGAATTGAACTCAGGTCCTCTGGAAGAACATCTTAACCCCTCCTAGCCT
Sequence Type genomic DNA
Unitrap ID UNI4488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84090300..84090373 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034453 (Polr3b) NM_027423 polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]

 
Come back to gene ENSMUSG00000034453


For any suggestions or comments, please send an email to unitrap@crg.es