Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10853H4
Clone ID IST10853H4
Vector VICTR76
Project tigm

Sequence tag IST10853H4HMF1
Sequence
AGGACAAGGGCCTTCAGGGTTTGGTCTGATNAAATCAAANCATTANNAACCAATCCCCACCCCAACGTGAACTGAAACTG
TTTGATAAGTTTTTTCCATATTTGAAGTTATGCAGTAATGTCATCTTGAGGTACATTAAGTAGTGTTTACAAATTGAGTA
NTTTTTTTCTGCATACTTACATTTTGTACTAGTATTTTACAAATATGTAATTTCCTTTCCTTAAACTTTTACTTTGAAAA
TCATATGGAAAAACAAAAGAATGTTCAATACTCAATATATTTTACCTTGTTTTTATATTTTGTCAGATTTGTTTTATGTG
AATTCTTTGCTTAATCACGTAAAANGAAGTTACAGGTAGTGAGATATATCACTTGTAAATACTTTTCTTATTTTAATGCT
AAGCATAAAGATATTTACGGTATGTTTTGTACTTTTGTTGTTTTAAATGTATATNANTACTCTGTCACTATCTTTANNCA
CCCTGGNANNANGGCATCCNATTATGGATGGNTGTGANACACTATGTGTTTGACTGGNAATTGAACN

Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21156979..21157522 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST10853H4BBF1
Sequence
AGGACAAGGGCCTTCAGGGTTTGGTCTGATTAAATCAAANCATTANAACCAATCCCCACCCCAACGTGAACTGAAACTGT
TTGATAAGTTTTTTCCATATTTGAAGTTATGCAGTAATGTCATCTTGAGGTACATTAAGTAGTGTTTACAAATTGAGTAG
TTTTTTTCTGCATACTTACATTTTGTACTANTATTTTACAAATATGTAATTTCCTTTCCTTAAACTTTNNCTTNNAAAAT
CATATGGAAAAACAAANNNNTGTTCAATACTCANTATATTTTACCTTGTTTTNATATTTTGTCAGATTTGTTTTATGTGA
ATTCTTTGCTTAATCACGTAAAANGAAGTTACAGGTAGTGANATATATCACTTGTAAATACTTTTNTTATTTNAATGCTA
AGCATAAAGATATTTACGGTATGNTTTGTACTTTTGNTGTTTTAAATGTATATGATNACTCTGNNNCTATCTTTANNCNC
CCTGGGANANGGCATNCCNTTNTGGNTGGNTGNGANACACTATGTGTTTNANTNGGAAATTGAACTCNNANCNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es