Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14543E6
Clone ID IST14543E6
Vector VICTR74
Project tigm

Sequence tag IST14543E6HMF1
Sequence
GTAAGTAAGTAAGTAAGTAAGTAAATAAATAAATAAATAAATAAATAAATAAATAAATAC
Sequence Type genomic DNA
Unitrap ID UNI31639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 68970068..68970126 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021536 (Adcy2) NM_153534 adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17526593..17526651 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 90331138..90331196 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 48627025..48627083 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21504862..21504920 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100773301..100773359 59
NO GENE  

 
Come back to gene ENSMUSG00000021536


For any suggestions or comments, please send an email to unitrap@crg.es