Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G041A05
Clone ID G041A05
Vector U3CEO
Project ggtc

Sequence tag G041A05
Sequence
GGTTCCATNNNACATTTTCTCAGAATCCTACGGAGGAAAGATGGCTGCTGGCATCAGTGTAGAACTTTACAAGGCTGTTC
AGCAAGGGACCATTAAGTGCAACTTTTCTGGGGTTGCTTTGGGTGACTCCTGGATCTCCCCCTCGTACTTAGTGGTGTAA
TGGGGTCATNNNGTATATAATAGTATAACCTTTACAACCTGCACCCAGATCCTATAGCCACATGACTGGTGCCTGACCCT
GTGCAGATGCAAAATTCGCCCNNCGCCACAGAATGCNNNNTCCTCGNNAAAATTGTACGATCNT
Sequence Type mRNA
Unitrap ID UNI11186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88802602..88805183 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es