Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12853F5
Clone ID IST12853F5
Vector VICTR76
Project tigm

Sequence tag IST12853F5HMF1
Sequence
CAGCCTAGCTGGTGGGTTGCAGGGGGGCTCCTGCCTGAGCCTCTCTGTGACCCCTCCTTTGTCATCTGTAGGCATGGTGA
CCAGCCGCCAGGTGCGCACCATTGTGGAGGAAGTCCAGGATGGTAAGGTGGTCTCCTCCANAGAGCANGTGCACCGCTCC
ACCCACTGAGGCCCCTGTCTGCGTATGATAGCCCAGGCCCAGGACCTTANGCTGCANCTCCCTGCATCTACTGCCAAGCC
TGAACTCCTATGAGCTANCTGTTGCCTTCTGTGTTTGCTTTGTGCTGCCCCTTACANANAGGCCCCTTGGGTTA
Sequence Type genomic DNA
Unitrap ID UNI31643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100124240..100124552 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053654 (Krt42) NM_212483 keratin 42 Gene [Source:MGI (curated);Acc:Krt42-001]

 
Come back to gene ENSMUSG00000053654


For any suggestions or comments, please send an email to unitrap@crg.es