Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14311D12
Clone ID IST14311D12
Vector VICTR74
Project tigm

Sequence tag IST14311D12HMF2
Sequence
NAGTTATCANAGATTTTTATAACCCCTCTCCTCCCAATTTTATTAGATTAATTTACACTTTCCTGCAAAAATCACATGCC
CACTGATCTAAGCTTGAAATTTTTCATACCATTTTCAGGGATATCTGATGTGCAGTGTAACATTTTTATTTTATCTTTTT
ATTTTTTGAGACAAGGTCTTACTGTAACCATGGCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI31653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180409049..180409248 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST14311D12BBF1
Sequence
CTACATGATGTCACTATGTAACTTTCTTAACTAAAACAACATGCATGTGTTATATATGTCCATGTTAAATAGGGCATGTA
TCTCAATATCTCTAAGTATAGTGATCTGTATCTATAGATTAAGCTAAGCAGGTTCATACTGAAATAACCCCCTTTCCTTG
CTTGCCTATATATTCCGGCTGCAAAACTGGGCATAATGGTGCACACACACNNTTAATNNNAGCACTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119288580..119288808 219
NO GENE  


Sequence tag IST14311D12HMR1
Sequence
TTTAAAATTTATTTATTTATGTATATGANTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es