Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0436
Clone ID CF0436
Vector pGT0lxr
Project sanger

Sequence tag CF0436
Sequence
GCCGATCTTATTTATTAGTTATTTCCGCCTCTTTATTTTCCGCCTGCACCAGGCAGCAGCGCAAACGAGTTTCCTCTGAG
ACCCACCAGGGCCCTGGCACTCCTGAGTCCAAGAAAGCTACCAGCTGCTTTCCACGCCCCATGACCCCCAGGGACCGGCA
TGAAGGACGTAAGCAGAGCAGCACTGCTGACACCCAGAAGAAAGCAGCTCCAGTTCTCAAACAGGCGGACCGGCGTCAGT
CAATGGCTTTCAGCATCCTTAACACACCTAAGAAGCTGGGAAATAGTCTTCTAAGGCGAGGAGCTTCAAAGAAGACCCCA
GCAAAGGTCTCCCCCAATCCTCGCAGTGGAACCCGCCGTTCTCCACGCATTGCCACCACCACAACTGGCAAAAATACTGT
TGCCACCACTCCTCGGGCCAAGGGCAAGGTCCAAAAG
Sequence Type mRNA
Unitrap ID UNI1449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109161800..109162457 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es