Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14782A8
Clone ID IST14782A8
Vector VICTR76
Project tigm

Sequence tag IST14782A8HMR1
Sequence
CTCTCTTAATGCTCTTGACCTCGGCACCACCCCAGCCTCTANCCTGCATTTCTTTTTCTTTTGTTCTTTTGAGACAGGGT
CTTGCTGTGTAGCACAAGCTGACCTGAAATTGGTGACCCTGCTGCCTCANCCTCCCTAATGCCCTGTGACACCATGCCTG
CTTTGTTACCCTCTTTAACTGCCCCCGTGCCTCAGTTTCTCCCTCTTANTCTCCAAACTGGCAACACTCAAGCCCATTAG
GATCTGACACCCCCTGGAGAGCCCTCTGGGGCGCACAGGTGCGCCGGCTTCGACTGTCCCTGCCCCTCCTGGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264645..86264959 309
 
EST/CDNA Est Name
  CA537951.1 - BY303636.1 - BB861825.1 - CA565322.1 - BY154149.1 - BY154045.1 - CN666483.1 - CJ164531.1 - CJ181219.1 - BY228558.1 - CJ164744.1 - BY039941.1 - CJ170699.1 - CJ161768.1 - CJ161457.1 - BB872122.1 - BB871768.1 - BY000796.1 - BY131864.1 - BY131842


Sequence tag IST14782A8HMF2
Sequence
AGAGGACCTGGCTGGGTCCCAGCACCTATATGGTGGCTCACAAGTGTCTGTAACTCCAGTTCCTGGGGATTCACACTGTC
TTCTGCATCCACGGGCAACAGACATGCAGTGCACAGACATACATGCAGTGTACAATAATACATGCAGTGCACAAACATAC
ATGCAGGCAAAACACATACAGTTTAAAAAAAAAAAAACCTAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI6526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264444..86264648 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]


Sequence tag IST14782A8BBF1
Sequence
ATACTTTGCTGTTATTCCTCTCCCTCCCCTAAACCCCCAGGAATTCCGGTTAAACTGATCTCCCAAGGGTAGAGGTAGCT
CAGACCAGTGCTGCCAAGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95457929..95458034 106
NO GENE  

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es