Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0574
Clone ID CD0574
Vector pGT0lxfT2
Project sanger

Sequence tag CD0574
Sequence
AAGTTGAGAGCCAGCAAGAAAGAGGTGCAGGGTCGCGCAGGAGATGGTGCCAGTGCGGGAGGCCTGGTTGCTGCTGTTGC
TCCAAAGGC
Sequence Type mRNA
Unitrap ID UNI1451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65642752..65642831 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es