Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14163C7
Clone ID IST14163C7
Vector VICTR74
Project tigm

Sequence tag IST14163C7HMR1
Sequence
NTAGGACAAGAGTGGAGCCNGGCGCTTTCCTCANACAGCCTCACTTTGTCTTCTCAGAGCGGTAGGGACCCTAGGCTTGT
CCCTCCAATACTAGGTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI19521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150188975..150189074 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052281 (OTTMUSG00000018795) predicted gene, OTTMUSG00000018795 Gene [Source:MGI Symbol;Acc:MGI:3705185]


Sequence tag IST14163C7HMF1
Sequence
CTAGGCACGGAGTAATTGAGGAGGGGGTTCTAGGTGGTTCCAGGCCCATCTTGGGTCCTGGAGGCTGCCTGACTCTTTCT
TCCNTGCAGGTAGAGAAAGGTGGTTAAGGATTGAGCAAGCAGGAGGCTCTGCTGCAGGAGGCCTGGCACACATGAAGCTT
NNCCACACCCTGANACTTGGCTGCACCTAAGCTGCTCTGCACCCTGGCTGGGTCTTGGAGTCTTCCCTGAGTGATATAGT
GGTCACCCCTCACCTACCCTACAGGCTGANAACTAAGANTCTGGGAAATGCNNGCTGCAGAGGAGACACCTGGAGTGCTG
GAANANCCCCTTNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150189072..150189404 309
NO GENE  

 
Come back to gene ENSMUSG00000052281


For any suggestions or comments, please send an email to unitrap@crg.es