Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13568D11
Clone ID IST13568D11
Vector VICTR74
Project tigm

Sequence tag IST13568D11HMR1
Sequence
TGTGTTTGTGTGCCTGTGTGAGTTTATATGCATCATACGTGTGCAGGTGCCCAGGGAGATTAGAGTGCTGAATTTGCTCA
AGTTGGAGTTGCAAGTGTTTGTGGGCTGTGTCATGTGGGTGCTGAGAACCGAACCCAGGCCCTTTGTAAGTTCTAGGTTA
GGGTATAGAGCATCTACCCCAGGGTGAT
Sequence Type genomic DNA
Unitrap ID UNI20766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153344722..153344909 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061411 (8430427H17Rik) NP_001127772 RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]

 
Come back to gene ENSMUSG00000061411


For any suggestions or comments, please send an email to unitrap@crg.es