Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10099G2
Clone ID IST10099G2
Vector VICTR76
Project tigm

Sequence tag IST10099G2BBR1
Sequence
CTTGAAAGTTGTCTTTGCCTCGGTTGAAGTGGTTTTCCATCCTGCTGTTGCGGGTGCCCTCTTGCTCTGAGAAGCCCATG
CTGCCACCCTTACACTCTGCTCTTGCATCTGGCCAACTTCATCTCTGGGAATGTGTCTCTTAGTAGCTTTCAAAGATGTA
GACAATGCTCTTTTCAGTCCTTAAGTGGCTGAGTATGAAACATCCGACAAGCTGGTTCTGCCCCACCACTTCCATATACA
TCTTTCAGCCATTCTCTCGGCATCTAGAGCATCTTGTATCCTTTGCATTCTAGCCTCTTTCTCTTTGACAGCCAGTGGTA
TCAGTGTCCTGTCTGTCCCAGACACACTCTGTGGTGACACTGAGGTAACTAGGTACCTGGCCCTCAAGGTTCTTAAGTCA
AATTTGCAGGAGGCTCCAGCAATATTAACAAGGACTGCCTCCACTTGTTTCCTGAGTACTGTCTCTGAATTTACCTATAG
GTTTAAACCAAGGGCTGGGGCTGACACTGAGTAGTCTAAAGTGTTCTGTCATCAGATGACACTGCCTATAGGCTTTGGTT
GAGCCTCAAGATGGGACCCCTTGGTACCA
Sequence Type genomic DNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80263051..80263640 575
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es