Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14496E7
Clone ID IST14496E7
Vector VICTR74
Project tigm

Sequence tag IST14496E7HMR1
Sequence
NNNGTTCTCTCAAACCCTGAACAAGGCACCCACCCTGTACTGGGATCTAATCTAAGAGACTCATACATGATAGGCANACA
CCAGTTTACTGCCCAACACAGACCTAAAGTGGCTTTCAACCCTATGGTTTAGTTCTAGGTTAAAGTGCTAACATTTGTGA
TCAGACCTGGGGATCATTGGGCATTCTATCTAGTTGGTGATCTTTANGTTCCTATGAAGAAAGACCCACTCANTCTTAAA
AAATGAGGTANANNATTCTTCTCTCTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30075212..30075480 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


Sequence tag IST14496E7BBF1
Sequence
CCTGTTGCTCTTACTGAGATCCTAAGTTTGATTCCCGGCACCCACATGGTGATTTGCAACTACCTATAAAGTCATTTCTA
GGAGATCATATACTCTCCTCTCTTCCTTGAACACTGAGCACACATATACATGCAGGCAAGCAAATCATTCACACATAAAA
TAAACCTAATTTTTACATTATCCAATTACCAATGAACCACAGTACAGAATTATCAACTCAGAAATAGAATCACTTACGCC
TTTTTAATGTCCTCAGGTGAGGCATGTCTCTGCACGCCCAGCACTTCATAGTAATCCACCATGTTTTAACTGACTGTTGG
AATAAATCCTGCAAATAAAAAAATACAGCCCATGATAACACTGCCCAATGAGTGAAAAACAAGAGGAANGATGAGAGTCG
GTTCCTTCTCAGCACCTACTGGCCCAGANAGAACTTCTGGTAGCNNGTCACTAGCCTGTATCTTANGCNGGACTTTTGTC
CAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30074729..30075212 472
 
EST/CDNA Est Name
  AW211110.1 - BX633822.1


Sequence tag IST14496E7HMF1
Sequence
CCTGTTGCTCTTACTGAGATCCTAAGTTTGATTCCCGGCACCCACATGGTGATTTGCAACTACCTATAAAGTCATTTCTA
GGAGATCATATACTCTCCTCTCTTCCTTGAACACTGAGCACACATATACATGCAGGCAAGCAAATCATTCACACATAAAA
TAAACCTAATTTTTACATTATCCAATTACCAATGAACCACAGTACAGAATTATCAACTCAGAAATAGAATCACTTACGCC
TTTTTAATGTCCTCAGGTGAGGCATGTCTCTGCACGCCCAGCACTTCATAGTAATCCACCATGTTTTAACTGACTGTTGG
AATAAATCCTGCAAATAAAAAAATACAGCCCATGATAACACTGCCCAATGAGTGAAAAACAAGAGGAANGGATGANAGTC
NGTTCCTTCTCAGCACCTACTGGCCCAGAGAGAACTTCTGGTAGCCAGTCACTANCCTGTATCTNNAGGCAGGANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30074738..30075212 459
 
EST/CDNA Est Name
  AW211110.1 - BX633822.1

 
Come back to gene AW211110.1 - BX633822.1


For any suggestions or comments, please send an email to unitrap@crg.es