Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11629E3
Clone ID IST11629E3
Vector VICTR76
Project tigm

Sequence tag IST11629E3HMR1
Sequence
NACNTACATTTTCTAAACAATATAACCTCACCTTTACTCTATTTCTTACATGATTTANCAACTCACACACAAAGAGATTT
CCCAGTCACTTGCCCTGAAAGCTCCACCCTTGTCTAGGGTTGATCCTC
Sequence Type genomic DNA
Unitrap ID UNI31666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737809..33737935 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]


Sequence tag IST11629E3BBF1
Sequence
NANTTGACAGGTAGAAGATAAAAGAAATACCTGATANCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737713..33737799 85
NO GENE  

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es