Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14782H7
Clone ID IST14782H7
Vector VICTR76
Project tigm

Sequence tag IST14782H7HMF1
Sequence
AAGCATATGTGAAGGTCTGGGTTTGATCCTTAGCACCACATAAAACCAGGGATGGTGGTGTATTCCCGTAATCTTGTAAT
CTAGAAGGTGGATGCGGGAGGACCAGAAATTCGAGGTTATCCTCTGCTGCATGGCGGAAGTGAGGTCAATCTGGGCTAAA
CGGGACTCTGTCTTAATACCAGAGCAAAACACAAACAAAACAGAACCCCAAATCAAACAATGTACACCCCCACCGTGATT
TAAAATACTACTTACCCTGTGACCATGGGGTCCCATAATTAATTTAGGTATTGCTTTATTTCTAGACTTTAATGCTTTTA
GTTTTGGCTATAACAAATTATACAAAGGATCTGTATATAATTTTTTGTTAATGTGTTTTTGACTATTTCCTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI31115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74364794..74365188 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038807 (Garnl4) NM_001015046 GTPase activating RANGAP domain-like 4 Gene [Source:MGI (curated);Acc:Garnl4-001]


Sequence tag IST14782H7HMR1
Sequence
GGGGCCNGCCTGGTCTAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAGAAACCCTGTCCGAAAAATTAATAAATACA
GGAGAGCTTTAACTCTGAATCCTATATATTATAATACCCACCAGCCAGGCAAGATGTGCCCAACTAGCACAACAATGGCA
TGACAGTTAAGGGGTTANCCNACTGCTTCCTAATTAGATTTGAGGCCTGTCCTAAAAGAGAGAGTTCAAATCTGGAACAA
TAAAGGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 117833598..117833848 245
NO GENE  


Sequence tag IST14782H7BBF2
Sequence
NCCNNNAANNNNAANNNNGCCNGNNNNNGCCNCCCAANTGCNGGNANNAAAGGAATGTGCCNNCNCTGTCCAACCTGTGT
TNANATTTAATCATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038807


For any suggestions or comments, please send an email to unitrap@crg.es