Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11297C6
Clone ID IST11297C6
Vector VICTR76
Project tigm

Sequence tag IST11297C6HMF1
Sequence
CCTCTACAGCATTGGGGGAGACTGANAGGATAGGGTANGATATTCTAGTCCTCACTCTGCCNNACACTTATGGGTGTGGC
TCTGGTCCTCTGCTTCCCTCTANGACTTAGTTTACTCCTTTGTAAAATGGGCATGTTGAACCACCCAATGGCCTTGGTAT
GCANCACATACCCCTCCTAAGGCTCCCTGCTTAAAGCCTCTGTTCTAAACN
Sequence Type genomic DNA
Unitrap ID UNI31671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30916449..30916658 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049265 (Kcnk3) NM_010608 potassium channel, subfamily K, member 3 Gene [Source:MGI Symbol;Acc:MGI:1100509]


Sequence tag IST11297C6BBF1
Sequence
CCTCTACAGCATTGGGGGAGACTGAGAGGATAGGGTAGGATATTCTAGTCCTCACTCTGCCNNACACTTATGGGTGTGGC
TCTGGTCCTCTGCTTCCCTCTAGGACTTANTTTACTCCTTTGTAAAATGGGCATGTTGAACCACCCAATGGCCTTGGTAT
GCANCACATACCCCTCCTAAGGCTCCCTGCTTAAAGCCTNTGTTCTAAACCTATGAGGCCCCTGCACAGANCTNGCCTTG
GGCTGGGGGGTGGGGGGGCGGCAAAGGANCTGANCCCTGAANCANGCCTGGCTGCNNNCCNNACTGTGTCTGCNNACACT
GACCTTGGCTGCTGCANGGATTTTCCATGACACCNNCACCCTCCCTCTNAACTCCNNNATTNNGNATGGGCCTGGGANGC
TGGNGGTGGNGCACCAGAGCTCTTCTGCATAAGANNTNCTCANNCNGTAACAGGGGACAGACACCTGTGGGGTGCAAGTN
ANCTCAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000049265


For any suggestions or comments, please send an email to unitrap@crg.es