Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14388D2
Clone ID IST14388D2
Vector VICTR74
Project tigm

Sequence tag IST14388D2HMR1
Sequence
TTCTAACCTCCCTGGGTTACAGGGTTACAAATTAGGGGATTACAAATAAAGAGGGACAGGTATAAGGTTGAGTTCACTGA
CCAACTTTGAAGCTGGTATACTTGCAGCACAGAAAAGGAGGAGGAATAAGGTAGGTGAGGCCTTTCTGCTTTGGCAGTAN
TTC
Sequence Type genomic DNA
Unitrap ID UNI31672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177685631..177685791 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078862 (OTTMUSG00000016327) predicted gene, OTTMUSG00000016327 Gene [Source:MGI Symbol;Acc:MGI:3709298]


Sequence tag IST14388D2HMF1
Sequence
AGACAACACTCATTCCCTGGTGTCTTTTGTCTCACTGATCAGTCAGAACCCAGCCTGAAAGCAGTTGTAGGACTGTTTTC
CAAGCCCTGGGCAGCAGAGGCTGGAAGAGGAGTTCAAAGCAAGTTTTAACTACATGACATAAAGAAAGTAGGAGCTACAG
GAGATGTTTCTCTAAACAGACAGATATGAAATCTCTTTAAAAATAGGAATGAAATTCTTAATTTTGGGGAAATATTGGAG
AATAGAAACACGTAAGACGTCAAATCACCTATGCATAATGAAAATGAAATTCAGAAATGTAATACCAAAATTTAATATTT
AAAAAGATCAATATAATTGAAAAAATATATTCCTGTACTGATTTGAAAAAGATCAGGCCCTTCCTGGTAGAAGGAATGTC
ATTAATAAGATAGCATTTGACCTTGCCCCTATGTGCTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177685789..177686230 442
 
EST/CDNA Est Name
  BY254695.1 - BY255196.1 - BE370177.1

 
Come back to gene BY254695.1 - BY255196.1 - BE370177.1


For any suggestions or comments, please send an email to unitrap@crg.es