Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11595D11
Clone ID IST11595D11
Vector VICTR76
Project tigm

Sequence tag IST11595D11HMR1
Sequence
CCCTGAGTGAGGGTGGCTCCTCGGTAGCAAAATGACAGCTGTATTCTAAAGTGTCACACTTTTGTCTATACAGTANTAAT
ACTTTCAAGCTGATATATAGAATGTTCTGGACTTGTAATCAGCATCAGCTATTAAAACACTGATGTCATAACTTGCAAAT
GAAGCCATGGAACGGCATCCGTGTGTAATANCCTGCTANTTTTTCACCTTGACCAATATTCTGTCATTTANATTATTCAG
AATTGAGCGACTATGCATATGTCC
Sequence Type genomic DNA
Unitrap ID UNI31675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63482129..63482391 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037257 (2310007F21Rik) NM_025857 RIKEN cDNA 2310007F21 gene Gene [Source:MGI Symbol;Acc:MGI:1914189]

 
Come back to gene ENSMUSG00000037257


For any suggestions or comments, please send an email to unitrap@crg.es