Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14809G5
Clone ID IST14809G5
Vector VICTR76
Project tigm

Sequence tag IST14809G5HMR1
Sequence
TGTAGCCTCCCAAGGAGTGGAGTGGGTTTTTGGGAAAGTGGAGTANAATGTTCTTTGGGAAAGGTGCCTGCGATGTTGCT
CTAGACCTGCCTCTTTCTGTANGAGCATTTTCTTCTGAAAAGATAATTTGGAGGGCATCTGTTAATCTAAATGTAATTAG
CAGAGGGCATCCCTCAGATAAGAGGATTGGAGCCATTTTGATGANCTATTTATTTCATTCTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI31282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9308418..9308646 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]


Sequence tag IST14809G5BBF1
Sequence
TAAGTACAATTGGAAGACACCCCTCAAACCCAGCGTGGTGGCACACGCCTTTCATCCCAGCACTCCGGAGGCAGAGGCAG
GCGGATTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9308327..9308415 89
NO GENE  


Sequence tag IST14809G5HMF1
Sequence
TAAGTACAATTGGAAGACACCCCTCAAACCCAGCGTGGTGGCACACGCCTTTCATCCCAGCACTCCGGAGGCAGAGGCAG
GCGGATTTAAAGAAAGAAAGAAAAAAAGGAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9308297..9308415 119
NO GENE  

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es