Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14539H8
Clone ID IST14539H8
Vector VICTR74
Project tigm

Sequence tag IST14539H8HMR1
Sequence
CTCNNACCCCAGTAAGCCCATGCAAAGAACACACAACTCAATTATAATATGATAAACAACACACCTAGATTGGGCAAATA
TACCACCATACTACTCTGTTTCCCAGCTATGAAATCCCTTGCTACTTGTGGTTCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI14534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77397748..77397885 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]


Sequence tag IST14539H8BBF1
Sequence
GATTTACCCCAACAGAATAACTAACACAAATCTTGCCNAAAGATATATTNNNGGTGGTATATTTTTANTTCCNTAAACTC
ATATCTTGGTAAAATACTTGGAATTTTGTACTTCGATGCAAGCAACCTCCAGAACAGACGGTATGATAAAAGAACTTACT
ATATTTATAGTGAACCTCTTTNNCCCNNNCCTGAGGTGTTTTAAGGAAAGTATCTAGATAAATACAGGANTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14539H8HMF1
Sequence
GGAGATTTACCCCAACAGAATAACTAACACAAATCTTGCCAAAAGATATATTCAGGGTGGTATATTTTTATTTCCCTAAA
CTCATATCTTGGTAAAATACTTGGANNNNNGTACTTCGATGCAAGCAACCTCCAGAACAGACGGTATGATAAAAGAACTT
ACTATATTTATAGTGAACCTCTTTCACCCAAACCTGAGGTGTTTTAAGGAAAGTATCTAGATAAATACAGGATTGGTGGG
AAGGATGGTTCTCAGGGAAACCAATCCTGTGCCAGANAATTGGAACTAGCACTATGCACCCAACTCTCACCTTAAAAGAA
AGGAAAGTAGCTGAAGGTTAAGTTAATCAATAGCTGATAGGTTAAAATCACCTTATGTAACAAATAACANAGGACCAGGA
ATCTGGGANGAAGATGAGAATGCACTAAGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77397882..77398315 418
 
EST/CDNA Est Name
  BB856962.1 - CN660527.1 - CA887175.1 - CN717636.1 - CA571154.1 - CA891173.1 - CA573124.1 - CN660671.1 - CN660253.1 - CN723862.1 - CN723856.1

 
Come back to gene BB856962.1 - CN660527.1 - CA887175.1 - CN717636.1 - CA571154.1 - CA891173.1 - CA573124.1 - CN660671.1 - CN660253.1 - CN723862.1 - CN723856.1


For any suggestions or comments, please send an email to unitrap@crg.es