Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14791A6
Clone ID IST14791A6
Vector VICTR76
Project tigm

Sequence tag IST14791A6BBF1
Sequence
CCACCTCACCTTAGAAATCCCTATTTTGCACTTTTTCCTTTTGGCTTTTTGAGGCAAGGTTTCTCTGT
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21263121..21263188 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]


Sequence tag IST14791A6HMF2
Sequence
CCACCTCACCTTAGAAATCCCTATTTTGCACTTTTTCCTTTTGGCTTTTTGAGGCAAGGTTTCTCTGTGGCTGGCCTGGA
ACTCACTCTGTAGACCAGGCTAGCCTCGAACTCACAGTGATCCACCTGCCTCTGCCTCCAAGTGCTGGCATTAAAGCTGT
GCACCACCACTGCATGGCTTACTTTTGTACTTTTTCATGGAACATCAGCTGCCACTGTTGCTGCTCCTGGTCCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21263121..21263357 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es