Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10835A5
Clone ID IST10835A5
Vector VICTR76
Project tigm

Sequence tag IST10835A5HMF1
Sequence
CATGTGGCTATGATGCTACACAGTGGAGGTGAACCTCTATACAAACAAGAGGAATATGACCAGCCTTGCNNAAAGTATAC
AATGATATTATTATATTTTAGGAAAAGTTAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44841925..44842036 108
NO GENE  


Sequence tag IST10835A5HMR1
Sequence
CATGTATGCCGTGTTTTAGCCCAGGAGTCAGTTCGTAGGTGACCNTCCTCCTCTGGGGATGTGACCNGATGGGCAGTGAT
GTCTCATCTGGATGCAGTTCTGTTTGACCCTCTGGGTCCATGTGACATCTTACCTTACGCTGTGACAGGCTGCTGACAGG
GCTGCTAGGACCTGAAGAGTGATATTGTGGGTAGGTCTGGGGTGCATAAGGGCACTTCCCCAAGTGCCTTTCANGGGACT
GANAGGAGCTANAAAAAGCCAGANAGGAAGCTGCCCAGAGCCAGCACCAAGAGGACATCAGGTACCCTGCCTCTCCCCAN
ANCCCAGAGCTCAGCGGTAGCTGTGANAAGAGGGAGGCACCCATCCCTAGTGTCGTTCTCAAGGTCTCACGGTCTANGCA
TTTACTCTAAACAAGTTATATTTTCNAATGAATGAAGGGCACAGGAACACAGGGTGGGGGTGACTNATCAGCTCTTAANA
AAAGCCAGGGNNNCCGANNGCCN
Sequence Type genomic DNA
Unitrap ID UNI628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44842033..44842534 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019849 (Prep) NM_011156 prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]


Sequence tag IST10835A5BBF1
Sequence
CATGTGGCTATGATGCTACACAGTGGANGTGAACCTCTATACAAACAAGAGGAATATGACCAGCCTTGCANANNNNNNAC
AATGATATTATTATATTTTAGGAAAANNNNACTCATGTNANGAAATGTAAAATATCATCTTAGAAATATTTCTCTTCCCC
AATAGATCCANGATAACNCANNNNNTTAAATTTNNNNTNNTTTATTTTTTATGAGGGTGAGATTCATCTAGGAGGCATTC
TGTAGGCTGGATGTGGCTGCTCATGGGGTTTGCGGATGCTATCTGCNCTGTANATTTTTGTGCANNTCANGGGCGGGACT
AANACTTACTATGGTGGTTTGCATAACAATGATGACGCCCATANGCCATANAAAGTGGTGCCATNANNAGATTCAGGCTT
GTTGGAGTANNTGTGGCTTTGTTGGANGAAATACATAACTAGGAAGTGGGCTCTGANGTCTCANAAGCTCANGCNNGCTN
ACTTCCTANGGCCTGCCNNTTGNNTGTNNAACTCTCAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019849


For any suggestions or comments, please send an email to unitrap@crg.es