Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11764F8
Clone ID IST11764F8
Vector VICTR76
Project tigm

Sequence tag IST11764F8BBF1
Sequence
CCTGGGGCTGGATAGATGGCTCAGCGGTTAAAAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCC
CATGGTGGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123054113..123054226 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]


Sequence tag IST11764F8HMF2
Sequence
GTCTNAACTTTCTCTTTATATTCTTANCAACTCTCCCCCCCTCCCCAACTGACTTTAATGCCAATCCCANACATCANTTA
ACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es