Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14648H5
Clone ID IST14648H5
Vector VICTR74
Project tigm

Sequence tag IST14648H5HMR1
Sequence
GGAGGAGGCCTAGTAGTGAGGCCACATGGGTCAAAGTGTGATGGCACAGCCTGGCCTCCAGTGTCTCGACTGGGTACAGC
TGTAATAGAACCGTCAGAGGGCCCAGGAGTGCACGCACGGTTACAGAGAGGCTTGAGTGTGTGTGGGAGTCTGTGCGACC
TCCAGATCCCAAGTTGCTAGTG
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59485630..59485811 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14648H5HMF1
Sequence
CTCCCACCTTCCTGTCCCCATTAGGCATTCTCCTTACTCTATTAACAACACACACACACACACACACACACACACACACA
CN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59485553..59485633 81
NO GENE  


Sequence tag IST14648H5BBF1
Sequence
CTCCCACCTTCCTGTCCCCATTAGGCATTCTCCTTACTCTATTAACAACACACACACACACACACACACACACACACACN
CNNTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59485555..59485633 79
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es