Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12201B7
Clone ID IST12201B7
Vector VICTR76
Project tigm

Sequence tag IST12201B7HMR1
Sequence
GGCAGAGCAATGCCTGCCAGGCCCTGGACAGCCTCTACCACACCCAGTGCTTTGTCTGCTGCN
Sequence Type genomic DNA
Unitrap ID UNI15057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55192236..55192297 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

 
Come back to gene ENSMUSG00000022178


For any suggestions or comments, please send an email to unitrap@crg.es